BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg912353 Length=264 Score E Sequences producing significant alignments: (Bits) Value AT1G26820.1 | Symbols: RNS3 | ribonuclease 3 | chr1:9292446-929... 174 3e-43 > AT1G26820.1 | Symbols: RNS3 | ribonuclease 3 | chr1:9292446-9293784 REVERSE LENGTH=1045 Length=1045 Score = 174 bits (94), Expect = 3e-43 Identities = 107/113 (95%), Gaps = 1/113 (1%) Strand=Plus/Plus Query 3 TTCTAGCGTTACAACAACTCTACGTA-AAAGTGTCGACCAGGATTTCGATTTCTTCTACT 61 |||||||||||||||||||||||||| ||||| ||| ||| ||||||||||||||||||| Sbjct 82 TTCTAGCGTTACAACAACTCTACGTACAAAGTTTCGCCCAAGATTTCGATTTCTTCTACT 141 Query 62 TCGTTTTACAGTGGCCTGGAACTTATTGTGATTCAAGACATAGTTGTTGCTAT 114 |||||||||||||||||||| | |||||||||||||||||||||||||||||| Sbjct 142 TCGTTTTACAGTGGCCTGGAGCGTATTGTGATTCAAGACATAGTTGTTGCTAT 194 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 12064259760 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5