BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg913552 Length=261 Score E Sequences producing significant alignments: (Bits) Value AT5G29015.1 | Symbols: | transposable element gene | chr5:1103... 167 5e-41 > AT5G29015.1 | Symbols: | transposable element gene | chr5:11031699-11038817 FORWARD LENGTH=7119 Length=7119 Score = 167 bits (90), Expect = 5e-41 Identities = 122/137 (89%), Gaps = 3/137 (2%) Strand=Plus/Plus Query 33 CAA-AGGACGTATTGTTGGAGTCTCTGATGAAGTACCATTACAAAACACACAAGGAGAGA 91 ||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||||||| Sbjct 6984 CAAGAGGTCGTATTGTTGGAGTCTCTGATGAAGTACCACTACAAAACACACAAGGAGAGA 7043 Query 92 TCCATGTTCCAGAACATGCACTAGAAAGCATCATACTTATTGACCA-GAACAATCGAGAA 150 | ||||||||||||||| |||| |||||| || ||| | |||| || || ||||||| || Sbjct 7044 TTCATGTTCCAGAACATACACTCGAAAGCGTCGTACATCTTGATCAAGA-CAATCGACAA 7102 Query 151 CTAGAAGAAGCTGGTGA 167 ||||||||| ||||||| Sbjct 7103 CTAGAAGAACCTGGTGA 7119 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 11913456513 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5