BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg913815 Length=300 Score E Sequences producing significant alignments: (Bits) Value AT2G32240.1 | Symbols: | FUNCTIONS IN: molecular_function unkn... 56.5 1e-07 > AT2G32240.1 | Symbols: | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: response to cadmium ion; LOCATED IN: plasma membrane; EXPRESSED IN: 25 plant structures; EXPRESSED DURING: 13 growth stages; CONTAINS InterPro DOMAIN/s: Prefoldin (InterPro:IPR009053); BEST Arabidopsis thaliana protein match is: unknown protein (TAIR:AT1G05320.3); Has 470429 Blast hits to 168274 proteins in 4282 species: Archae - 6896; Bacteria - 131956; Metazoa - 175525; Fungi - 33166; Plants - 25441; Viruses - 2243; Other Eukaryotes - 95202 (source: NCBI BLink). | chr2:13684299-13691155 REVERSE LENGTH=4480 Length=4480 Score = 56.5 bits (30), Expect = 1e-07 Identities = 30/30 (100%), Gaps = 0/30 (0%) Strand=Plus/Plus Query 25 AGAAATTTGAAGAGCTGCATAAGCAAAGTG 54 |||||||||||||||||||||||||||||| Sbjct 807 AGAAATTTGAAGAGCTGCATAAGCAAAGTG 836 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 13873898724 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5