BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg915758 Length=204 Score E Sequences producing significant alignments: (Bits) Value AT5G44500.1 | Symbols: | Small nuclear ribonucleoprotein famil... 121 3e-27 > AT5G44500.1 | Symbols: | Small nuclear ribonucleoprotein family protein | chr5:17927453-17929463 FORWARD LENGTH=1132 Length=1132 Score = 121 bits (65), Expect = 3e-27 Identities = 67/68 (99%), Gaps = 0/68 (0%) Strand=Plus/Plus Query 1 ATGTCGATGTCGAAGAGCTCCAAGATGCTTCAGTTCATAAACTACAGGATGCGAGTAACG 60 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 53 ATGTCGATGTCGAAGAGCTCCAAGATGCTTCAGTTCATAAACTACAGGATGCGAGTAACA 112 Query 61 ATCCAAGA 68 |||||||| Sbjct 113 ATCCAAGA 120 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9104544531 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5