BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg915927 Length=798 Score E Sequences producing significant alignments: (Bits) Value AT2G45590.1 | Symbols: | Protein kinase superfamily protein | ... 102 5e-21 > AT2G45590.1 | Symbols: | Protein kinase superfamily protein | chr2:18786658-18788988 FORWARD LENGTH=2331 Length=2331 Score = 102 bits (55), Expect = 5e-21 Identities = 62/65 (95%), Gaps = 1/65 (2%) Strand=Plus/Plus Query 125 AGAGA-ATTGGTGGTGGAAACATGACAACAATGGTGGAAGCAGAGGAGGGATTGAATCAA 183 ||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||| Sbjct 1173 AGAGAGATTGGTGGTGGAAACAGGACAACAATGGTGGAAGCAGAGGAGGGATTGAATCAG 1232 Query 184 GGAGT 188 ||||| Sbjct 1233 GGAGT 1237 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 38830995631 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5