BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg915946 Length=192 Score E Sequences producing significant alignments: (Bits) Value AT5G38660.1 | Symbols: APE1 | acclimation of photosynthesis to ... 130 5e-30 > AT5G38660.1 | Symbols: APE1 | acclimation of photosynthesis to environment | chr5:15473109-15475552 REVERSE LENGTH=1092 Length=1092 Score = 130 bits (70), Expect = 5e-30 Identities = 83/89 (93%), Gaps = 2/89 (2%) Strand=Plus/Plus Query 9 AAGAGCTGCTGATTCCACGAGCTCTTCTCCATCAGTAGCTTCCGGTGATAGAGCCCTAAT 68 |||||||||||||||||||||||||||||||||||||||||||||||||||| || |||| Sbjct 247 AAGAGCTGCTGATTCCACGAGCTCTTCTCCATCAGTAGCTTCCGGTGATAGAACCTTAAT 306 Query 69 -CCATGATGATGAATTCACTCAAGCCAAG 96 || |||||||||||||||| ||||||| Sbjct 307 TCC-TGATGATGAATTCACTTTAGCCAAG 334 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 8500928319 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5