BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg916063 Length=216 Score E Sequences producing significant alignments: (Bits) Value AT4G27180.1 | Symbols: ATK2, KATB | kinesin 2 | chr4:13614856-1... 152 1e-36 > AT4G27180.1 | Symbols: ATK2, KATB | kinesin 2 | chr4:13614856-13619156 REVERSE LENGTH=2612 Length=2612 Score = 152 bits (82), Expect = 1e-36 Identities = 98/105 (93%), Gaps = 3/105 (3%) Strand=Plus/Plus Query 25 TTA-AAGGAGAGATGTGAGAATATGATCGAATATGTAAAAAGGCTTAGGCTTTGCATTAG 83 ||| ||||||||||||||||||| ||| || ||||||||||||||||||||||||||||| Sbjct 335 TTACAAGGAGAGATGTGAGAATACGATGGACTATGTAAAAAGGCTTAGGCTTTGCATTAG 394 Query 84 ATGGTTTCAAGAACTCGAGTTAGATTACGTC-TTTGAGCAAGAGA 127 ||||||||||||||||||||||||||| | | ||||||||||||| Sbjct 395 ATGGTTTCAAGAACTCGAGTTAGATTATG-CATTTGAGCAAGAGA 438 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9651407808 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5