BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg916316 Length=261 Score E Sequences producing significant alignments: (Bits) Value AT3G48070.2 | Symbols: | RING/U-box superfamily protein | chr3... 95.3 2e-19 > AT3G48070.2 | Symbols: | RING/U-box superfamily protein | chr3:17750712-17752761 FORWARD LENGTH=1307 Length=1307 Score = 95.3 bits (51), Expect = 2e-19 Identities = 53/54 (98%), Gaps = 0/54 (0%) Strand=Plus/Plus Query 145 GCCAAATTGAAACAGAGCAAGCTAGGTCTTCGTCGTGAGCAATGGCTTTCTCAA 198 |||||||||||||||||||||||||||||||||||||| ||||||||||||||| Sbjct 254 GCCAAATTGAAACAGAGCAAGCTAGGTCTTCGTCGTGAACAATGGCTTTCTCAA 307 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 11913456513 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5