BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg916592 Length=1302 Score E Sequences producing significant alignments: (Bits) Value AT3G30849.1 | Symbols: | unknown protein; LOCATED IN: endomemb... 119 8e-26 > AT3G30849.1 | Symbols: | unknown protein; LOCATED IN: endomembrane system; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr3:12629618-12629719 FORWARD LENGTH=102 Length=102 Score = 119 bits (64), Expect = 8e-26 Identities = 94/107 (88%), Gaps = 8/107 (7%) Strand=Plus/Plus Query 1 ATGTATCTCATGAATG-CTCCTAATCTAAATCTAGCTACCTATGTTGCATTTGATGATTT 59 |||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||| Sbjct 1 ATGTCTCTCATGAATGCCT-CTAATCTAAATCTAGCTACCTATGTTGCATTTGATGATTT 59 Query 60 ACAACTTGGAA-TGCATGCTCAACACGTTGTTG-CTCGTATTGTTAG 104 |||||||||| | || || |||| ||| ||| || |||||||||| Sbjct 60 GCAACTTGGAACT-CACGCCCAAC--GTTATTGGCT-GTATTGTTAG 102 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 64055895420 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5