BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg916919 Length=621 Score E Sequences producing significant alignments: (Bits) Value AT5G52910.1 | Symbols: ATIM | timeless family protein | chr5:21... 84.2 1e-15 > AT5G52910.1 | Symbols: ATIM | timeless family protein | chr5:21457627-21463159 REVERSE LENGTH=3573 Length=3573 Score = 84.2 bits (45), Expect = 1e-15 Identities = 51/54 (94%), Gaps = 0/54 (0%) Strand=Plus/Plus Query 568 CAGGAAGAGCAGGAAAAATCAGAAGAACAAGCAGCACACAAGATCAAGCAATGA 621 |||||||||||||||||||||||||||||||||||| ||| |||||| |||||| Sbjct 3048 CAGGAAGAGCAGGAAAAATCAGAAGAACAAGCAGCAAACAGGATCAATCAATGA 3101 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 29939551612 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5