BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg917300 Length=255 Score E Sequences producing significant alignments: (Bits) Value AT1G09270.1 | Symbols: IMPA-4 | importin alpha isoform 4 | chr1... 139 1e-32 > AT1G09270.1 | Symbols: IMPA-4 | importin alpha isoform 4 | chr1:2994369-2998222 FORWARD LENGTH=2143 Length=2143 Score = 139 bits (75), Expect = 1e-32 Identities = 90/97 (93%), Gaps = 1/97 (1%) Strand=Plus/Plus Query 109 agaCAGGGGTCGATGCCGATGAGGCGAGGCGGAGGAGAGAGGACAATCTCGTCGAGATTA 168 ||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||| Sbjct 187 AGACAGGCGTCGATGCCGATGAGGCCAGGCGGAGGAGAGAGGACAATCTCGTCGAGATTA 246 Query 169 GaaaaaaaCAAGCGTGATGATAGTCTCCTCACGAAGC 205 | ||||| ||||||||| |||||||| |||| ||||| Sbjct 247 GGAAAAA-CAAGCGTGAGGATAGTCTTCTCAAGAAGC 282 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 11611850019 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5