BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg918913 Length=1219 Score E Sequences producing significant alignments: (Bits) Value AT1G01355.1 | Symbols: | Putative endonuclease or glycosyl hyd... 128 1e-28 > AT1G01355.1 | Symbols: | Putative endonuclease or glycosyl hydrolase | chr1:138513-139568 FORWARD LENGTH=687 Length=687 Score = 128 bits (69), Expect = 1e-28 Identities = 114/135 (84%), Gaps = 6/135 (4%) Strand=Plus/Plus Query 843 GTCGGTCCGTGTATTAAACGGTTTTTGGAG-AATAAAGGCTACTCTGGTCCTCTCACCAT 901 |||||||||||||| |||||| ||||||| ||| |||||||||||||||||||||||| Sbjct 64 GTCGGTCCGTGTATAAAACGGGCTTTGGAGAAAT-TAGGCTACTCTGGTCCTCTCACCAT 122 Query 902 CACTGCCAT-GGGCGCACTAGA-AGACGTCCCTTATGACATCCTGAGAGGAGTCCATTCA 959 ||||||| | ||| |||| | |||||||||| ||||| |||| ||| ||||||||| Sbjct 123 CACTGCCGTTGGGAT-ACTA-ACAGACGTCCCTCATGACTTCCTCAGACAAGTCCATTCC 180 Query 960 AGTGGAATCGCTCTT 974 ||||||||||||| Sbjct 181 TCTGGAATCGCTCTT 195 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 59889250185 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5