BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg920107 Length=713 Score E Sequences producing significant alignments: (Bits) Value AT2G07717.1 | Symbols: | pseudogene, similar to NADH-ubiquinon... 117 2e-25 > AT2G07717.1 | Symbols: | pseudogene, similar to NADH-ubiquinone oxidoreductase chain 4 (EC 1.6.5.3). (Field mustard), blastp match of 99% identity and 2.0e-226 P-value to SP|Q04050|NU4M_BRACM NADH-ubiquinone oxidoreductase chain 4 (EC 1.6.5.3). (Field mustard) {Brassica campestris} | chr2:3418229-3424177 FORWARD LENGTH=5949 Length=5949 Score = 117 bits (63), Expect = 2e-25 Identities = 70/73 (96%), Gaps = 1/73 (1%) Strand=Plus/Minus Query 559 TGGATATCTCTGCGCCCCCCGCCCCGAAACTGACCCACAGCACAGCGCCCATTCGCTTTG 618 ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3604 TGG-TATCTCTGCGCCCCCCGCCCCGAAACTGACCCACAGCACAGCGCCCATTCGCTTTG 3546 Query 619 GGGGCGGGAAGGC 631 | |||||||||| Sbjct 3545 CGCGCGGGAAGGC 3533 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 34561093136 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5