BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg920172 Length=254 Score E Sequences producing significant alignments: (Bits) Value AT1G12800.1 | Symbols: | Nucleic acid-binding, OB-fold-like pr... 135 1e-31 > AT1G12800.1 | Symbols: | Nucleic acid-binding, OB-fold-like protein | chr1:4361551-4365331 REVERSE LENGTH=2673 Length=2673 Score = 135 bits (73), Expect = 1e-31 Identities = 87/94 (93%), Gaps = 0/94 (0%) Strand=Plus/Plus Query 27 GCCTGATCCACTAACCGAAGCCTTAGAATCTGTAGTTGGTGGTGATAATGATCAGTTCGG 86 ||||||||| || || ||||| ||||||||||||||||||||||||||||||||||| || Sbjct 2101 GCCTGATCCTCTTACTGAAGCTTTAGAATCTGTAGTTGGTGGTGATAATGATCAGTTGGG 2160 Query 87 GGGACGGTTACAAGTAGCAGAGCTCGACGCTGAG 120 |||||| ||||||| ||||||||||||||||||| Sbjct 2161 GGGACGATTACAAGCAGCAGAGCTCGACGCTGAG 2194 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 11561582270 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5