BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg920201 Length=204 Score E Sequences producing significant alignments: (Bits) Value AT1G13280.1 | Symbols: AOC4 | allene oxide cyclase 4 | chr1:454... 69.4 1e-11 > AT1G13280.1 | Symbols: AOC4 | allene oxide cyclase 4 | chr1:4547454-4548875 FORWARD LENGTH=1258 Length=1258 Score = 69.4 bits (37), Expect = 1e-11 Identities = 109/140 (78%), Gaps = 19/140 (14%) Strand=Plus/Minus Query 73 GGAAGGTGGAGTTCACGCGCTTAAATCCAGCTT-T-GT-A-GAGACATTAT-ACGCATTA 127 ||||||||||||||||||||||||||||||||| | | | | |||| || |||| ||| Sbjct 1105 GGAAGGTGGAGTTCACGCGCTTAAATCCAGCTTATAGGGACGGGACAC-ATTACGC-TTA 1048 Query 128 CGAGT-CGGCTCTATAGTACACATTAAAAAGCCCAATACAAAGGCCCATTATTAAAATGT 186 |||| |||| | | | |||| | | || || || ||||||||||||||||||| Sbjct 1047 CGAGAACGGCCC-A-A-TACA-A--AG---GCTCATTATTTAGGCCCATTATTAAAATGT 997 Query 187 TAACACAATGAA-A-CAGCC 204 ||||||||||| | ||||| Sbjct 996 AAACACAATGAACAACAGCC 977 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9104544531 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5