BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg920240 Length=344 Score E Sequences producing significant alignments: (Bits) Value AT1G27150.1 | Symbols: | Tetratricopeptide repeat (TPR)-like s... 95.3 3e-19 > AT1G27150.1 | Symbols: | Tetratricopeptide repeat (TPR)-like superfamily protein | chr1:9429047-9432274 FORWARD LENGTH=1743 Length=1743 Score = 95.3 bits (51), Expect = 3e-19 Identities = 55/57 (96%), Gaps = 0/57 (0%) Strand=Plus/Plus Query 212 TCAGGTTCTTCAACATGAATGTCAGTTTAAAGAAGCAGTGGAGTTCATGGAAGCACT 268 ||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| Sbjct 727 TCATGTTCTTCAACATGAATGTCGGTTTAAAGAAGCAGTGGAGTTCATGGAAGCACT 783 Score = 52.8 bits (28), Expect = 2e-06 Identities = 31/32 (97%), Gaps = 1/32 (3%) Strand=Plus/Plus Query 290 TTGTGTCATGTTCTTCAACATGAATGTCAGGT 321 |||||||||||||||||||||||||||| ||| Sbjct 722 TTGTGTCATGTTCTTCAACATGAATGTC-GGT 752 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 16085679680 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5