BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg922027 Length=385 Score E Sequences producing significant alignments: (Bits) Value AT4G34490.1 | Symbols: ATCAP1, CAP 1, CAP1 | cyclase associated... 54.7 6e-07 > AT4G34490.1 | Symbols: ATCAP1, CAP 1, CAP1 | cyclase associated protein 1 | chr4:16484530-16487417 REVERSE LENGTH=1859 Length=1859 Score = 54.7 bits (29), Expect = 6e-07 Identities = 31/32 (97%), Gaps = 0/32 (0%) Strand=Plus/Plus Query 108 AAGAAGCTGCTTGTTCGCATCAAGCAAACTCA 139 ||| |||||||||||||||||||||||||||| Sbjct 330 AAGGAGCTGCTTGTTCGCATCAAGCAAACTCA 361 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 18146657389 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5