BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg922155 Length=304 Score E Sequences producing significant alignments: (Bits) Value AT1G29740.1 | Symbols: | Leucine-rich repeat transmembrane pro... 126 1e-28 > AT1G29740.1 | Symbols: | Leucine-rich repeat transmembrane protein kinase | chr1:10407379-10412997 REVERSE LENGTH=3237 Length=3237 Score = 126 bits (68), Expect = 1e-28 Identities = 100/115 (87%), Gaps = 4/115 (3%) Strand=Plus/Plus Query 34 TTACTAGATGGAACATTGATTGCGATAAAGAAGCTATCTTCCAAATCATGTCAAGGCAC- 92 |||| | ||||||| ||||||||| | ||||||||||||||||||||||||||||||| Sbjct 2086 TTACCAAATGGAACGTTGATTGCGGTCAAGAAGCTATCTTCCAAATCATGTCAAGGCAAT 2145 Query 93 AAAGA-TTTGTAAACGAGATCAGTATGATCACTTGCCCCTGCAGCACCCGAATCT 146 ||||| ||| ||||||||||| |||| ||| |||| | |||||||||||||||| Sbjct 2146 AAAGAGTTTATAAACGAGATCGGTATAATCGCTTGTC--TGCAGCACCCGAATCT 2198 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14074969720 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5