BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg922471 Length=307 Score E Sequences producing significant alignments: (Bits) Value AT1G77500.1 | Symbols: | Protein of unknown function (DUF630 a... 215 2e-55 > AT1G77500.1 | Symbols: | Protein of unknown function (DUF630 and DUF632) | chr1:29121489-29125191 FORWARD LENGTH=3158 Length=3158 Score = 215 bits (116), Expect = 2e-55 Identities = 135/144 (94%), Gaps = 2/144 (1%) Strand=Plus/Plus Query 135 GGCGTCAATA-TTATCTTATCCAGGATCATGTATCTGGTAGCACCATCTACACGGTCATC 193 ||||| || | ||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 1729 GGCGTTAA-AGTTATCTTATCCAGGATCATGTATCTGGTAGCACCATCCACACGGTCATC 1787 Query 194 GCACTCTCGGCCCAGACTATCAATACGTTTAACATCTAGGACACGGAAAATGGCGAAAGC 253 |||||||| |||||||||||||||||||||||||||||| || || |||||||||||| | Sbjct 1788 GCACTCTCAGCCCAGACTATCAATACGTTTAACATCTAGAACTCGAAAAATGGCGAAATC 1847 Query 254 ATACAATGGACAAGATGTTAATGG 277 |||||||||||||||||||||||| Sbjct 1848 ATACAATGGACAAGATGTTAATGG 1871 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14225772967 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5