BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg922485 Length=231 Score E Sequences producing significant alignments: (Bits) Value AT1G33810.1 | Symbols: | unknown protein; FUNCTIONS IN: molecu... 137 3e-32 > AT1G33810.1 | Symbols: | unknown protein; FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: chloroplast thylakoid membrane, chloroplast, chloroplast envelope; EXPRESSED IN: 22 plant structures; EXPRESSED DURING: 13 growth stages; Has 39 Blast hits to 39 proteins in 18 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 39; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:12265033-12266847 FORWARD LENGTH=660 Length=660 Score = 137 bits (74), Expect = 3e-32 Identities = 78/80 (98%), Gaps = 0/80 (0%) Strand=Plus/Plus Query 152 TGTGAATGGACCCAGCATTGTTAGATTGATTAAAATATGTCCTCAAAGAGATGTTTTGTA 211 ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| Sbjct 490 TGTGAATGGACCCAGCACTGTTAGATTGATTAAAATATGTCCTCAAAGAGATGTTTTGTA 549 Query 212 TGAATTTTCGTAAGTACAAT 231 ||||||||| |||||||||| Sbjct 550 TGAATTTTCCTAAGTACAAT 569 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 10405424043 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5