BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg922663 Length=419 Score E Sequences producing significant alignments: (Bits) Value AT1G35183.1 | Symbols: | unknown protein; Has 5 Blast hits to ... 113 1e-24 > AT1G35183.1 | Symbols: | unknown protein; Has 5 Blast hits to 5 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 5; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:12884438-12884590 FORWARD LENGTH=153 Length=153 Score = 113 bits (61), Expect = 1e-24 Identities = 104/123 (85%), Gaps = 10/123 (8%) Strand=Plus/Plus Query 238 TGGAAAGAAACAACTT-ATTTCCG-GAACGAT-ATGATGAGGAGACGA-GATCAGAACAA 293 ||||||| |||||||| | || || |||| || | | |||||| || | ||||| | | | Sbjct 2 TGGAAAGTAACAACTTCA-TT-CGTGAAC-ATGACGTTGAGGACAC-AGGATCATATC-A 56 Query 294 GG-AGAGTCGGAGACGGAATCTGAGAGTTCTGACGATGAGGAGACAGAATCCGATAATTT 352 || |||||||||||||||||||||||||||||| ||||||||||||||||||||| || | Sbjct 57 GGAAGAGTCGGAGACGGAATCTGAGAGTTCTGAAGATGAGGAGACAGAATCCGATGATAT 116 Query 353 GGA 355 ||| Sbjct 117 GGA 119 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 19855760855 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5