BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg922909 Length=664 Score E Sequences producing significant alignments: (Bits) Value AT3G21960.2 | Symbols: | Receptor-like protein kinase-related ... 71.3 1e-11 > AT3G21960.2 | Symbols: | Receptor-like protein kinase-related family protein | chr3:7737156-7739542 FORWARD LENGTH=1326 Length=1326 Score = 71.3 bits (38), Expect = 1e-11 Identities = 60/70 (86%), Gaps = 3/70 (4%) Strand=Plus/Plus Query 187 AATTCAACATCTTTAAGGTTAGTATTCATGAATCCGA-AAGTTTGAGGAAGAACGGCATT 245 |||| |||| ||||| || || |||||| ||| | | |||||||||||||||||||||| Sbjct 822 AATT-AACAACTTTATGGGTATTATTCAAGAA-ACAAGAAGTTTGAGGAAGAACGGCATT 879 Query 246 ATGATCCCGT 255 |||||||||| Sbjct 880 ATGATCCCGT 889 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 32099619933 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5