BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg922921 Length=303 Score E Sequences producing significant alignments: (Bits) Value AT1G48690.1 | Symbols: | Auxin-responsive GH3 family protein |... 54.7 5e-07 > AT1G48690.1 | Symbols: | Auxin-responsive GH3 family protein | chr1:18009057-18009989 REVERSE LENGTH=732 Length=732 Score = 54.7 bits (29), Expect = 5e-07 Identities = 29/29 (100%), Gaps = 0/29 (0%) Strand=Plus/Plus Query 275 ATGAGTGATTATTTCAAGAACCGGCCATC 303 ||||||||||||||||||||||||||||| Sbjct 592 ATGAGTGATTATTTCAAGAACCGGCCATC 620 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14024701971 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5