BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg922937 Length=211 Score E Sequences producing significant alignments: (Bits) Value AT5G43680.1 | Symbols: | unknown protein; Has 30201 Blast hits... 117 4e-26 > AT5G43680.1 | Symbols: | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr5:17544029-17545752 FORWARD LENGTH=1142 Length=1142 Score = 117 bits (63), Expect = 4e-26 Identities = 86/96 (90%), Gaps = 5/96 (5%) Strand=Plus/Plus Query 19 CAATGGCTCAAGAATTTAGTGGCTC-T--TTGGCTTCAGTTAACCTGCACGCTCAAGCAA 75 ||| ||||||||||||||||||||| | | ||||| |||||||||||||||||||||| Sbjct 425 CAAAGGCTCAAGAATTTAGTGGCTCGTCGTCAGCTTCTGTTAACCTGCACGCTCAAGCAA 484 Query 76 CATCATTTGCACGATTATCTGAGACGGAT-AATGGA 110 ||||||||||||||||||||||||| | | |||||| Sbjct 485 CATCATTTGCACGATTATCTGAGACAG-TCAATGGA 519 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9400069063 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5