BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg922968 Length=396 Score E Sequences producing significant alignments: (Bits) Value AT2G42320.1 | Symbols: | nucleolar protein gar2-related | chr2... 132 3e-30 > AT2G42320.1 | Symbols: | nucleolar protein gar2-related | chr2:17627962-17630797 FORWARD LENGTH=2290 Length=2290 Score = 132 bits (71), Expect = 3e-30 Identities = 122/145 (84%), Gaps = 9/145 (6%) Strand=Plus/Plus Query 238 AAGTGTATAGCTCGAATT-GATGTAGCTATGTTCAACGCAATTCTGCC-TGAGTCAGAGC 295 |||||||| | | | ||| |||||||| ||||| || || ||||| || || ||||| | Sbjct 1401 AAGTGTATCGGTAG-ATTCGATGTAGCCATGTTTAATGCTATTCT-CCGCGAATCAGAAC 1458 Query 296 ATCAGATTCCCACTGATCCTGTCTCTGATCCTATTCTTGATTCCAAAGTTCTGCCT---C 352 |||||||||| ||||||||||||||||||||||||||||||||||||||||||||| | Sbjct 1459 ATCAGATTCCAACTGATCCTGTCTCTGATCCTATTCTTGATTCCAAAGTTCTGCCTATTC 1518 Query 353 CTTGCTGGAGATTTATGCATTAGGA 377 || |||||||| ||| || || ||| Sbjct 1519 CT-GCTGGAGACTTAAGCTTT-GGA 1541 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 18699602628 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5