BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg923064 Length=296 Score E Sequences producing significant alignments: (Bits) Value AT3G31051.1 | Symbols: | unknown protein; Has 30201 Blast hits... 122 1e-27 > AT3G31051.1 | Symbols: | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr3:12667227-12667370 FORWARD LENGTH=144 Length=144 Score = 122 bits (66), Expect = 1e-27 Identities = 111/131 (85%), Gaps = 9/131 (7%) Strand=Plus/Plus Query 171 CCTTTTGCACTTGTTCCTGGCACTATTCGCTCGTGCTATGGATCACATCGTGCCTCTTGC 230 ||| |||||| |||||||| |||||||| ||||||||| |||||||||| |||||||||| Sbjct 6 CCTCTTGCACATGTTCCTGACACTATTCACTCGTGCTACGGATCACATCATGCCTCTTGC 65 Query 231 ACTTCTTCCTGGCACTT-----T-AT--ACTCGTCGGCTCGTCAGCCATCCTGATCTATC 282 |||| ||||| |||||| | | ||||||||||||||||||||||||||||||| Sbjct 66 ACTTGTTCCTAGCACTTCACACTCGTCGGCTCGTCGGCTCGTCAGCCATCCTGATCTATC 125 Query 283 CGCAA-CCCGC 292 |||| ||||| Sbjct 126 TGCAAACCCGC 136 Score = 111 bits (60), Expect = 3e-24 Identities = 70/75 (93%), Gaps = 0/75 (0%) Strand=Plus/Plus Query 67 CCTCTTGCACGTGTTCCTGGCACTAATCACTCGTGCTACGGATCACATCATGCCTATTGC 126 |||||||||| |||||||| ||||| ||||||||||||||||||||||||||||| |||| Sbjct 6 CCTCTTGCACATGTTCCTGACACTATTCACTCGTGCTACGGATCACATCATGCCTCTTGC 65 Query 127 ACTTGTTCCTGGCAC 141 |||||||||| |||| Sbjct 66 ACTTGTTCCTAGCAC 80 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 13672827728 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5