BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg923263 Length=532 Score E Sequences producing significant alignments: (Bits) Value AT2G02660.1 | Symbols: | F-box associated ubiquitination effec... 84.2 1e-15 AT2G16450.1 | Symbols: | F-box and associated interaction doma... 63.9 1e-09 > AT2G02660.1 | Symbols: | F-box associated ubiquitination effector family protein | chr2:738504-739769 FORWARD LENGTH=1266 Length=1266 Score = 84.2 bits (45), Expect = 1e-15 Identities = 100/124 (81%), Gaps = 14/124 (11%) Strand=Plus/Plus Query 200 TGAAGGGATATGCATCAATGGGGTTTAT-TATTACTTTGCTGTA-CGAACTGA-CAAAGA 256 ||| |||||||||||||||||||||| | |||| ||| |||| | ||| ||| | ||| Sbjct 594 TGATGGGATATGCATCAATGGGGTTT-TGTATTTCTTAGCTG-AGAGAAATGAGC-TAGA 650 Query 257 GTACTATGAAACGCATGTGATAGTTTGCTTTGATGTTAGGTCTGAGATATTCA-AGTTTA 315 || | || | ||||||||||||||||||||||||||||||||| ||||| | | || Sbjct 651 GT-C--TG--A-TTATGTGATAGTTTGCTTTGATGTTAGGTCTGAGAAATTCACA-TATA 703 Query 316 TTGA 319 |||| Sbjct 704 TTGA 707 > AT2G16450.1 | Symbols: | F-box and associated interaction domains-containing protein | chr2:7131520-7132803 REVERSE LENGTH=1284 Length=1284 Score = 63.9 bits (34), Expect = 1e-09 Identities = 42/46 (91%), Gaps = 0/46 (0%) Strand=Plus/Plus Query 274 TGATAGTTTGCTTTGATGTTAGGTCTGAGATATTCAAGTTTATTGA 319 |||||||||||||||||||||||||||| | ||||| |||||||| Sbjct 725 TGATAGTTTGCTTTGATGTTAGGTCTGAAAAATTCACCTTTATTGA 770 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 25468712529 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5