BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg923735 Length=291 Score E Sequences producing significant alignments: (Bits) Value AT3G66658.2 | Symbols: ALDH22A1 | aldehyde dehydrogenase 22A1 |... 145 3e-34 > AT3G66658.2 | Symbols: ALDH22A1 | aldehyde dehydrogenase 22A1 | chr3:2095105-2099151 REVERSE LENGTH=2165 Length=2165 Score = 145 bits (78), Expect = 3e-34 Identities = 89/94 (95%), Gaps = 2/94 (2%) Strand=Plus/Plus Query 76 TGATCGTTCTCGCCTTCGCTTACGCGATCTGCAAATTCTTTCTTATGCTCATTCCTCCCA 135 ||||||| |||||||||||||||||||||||||| ||| ||||||||||||||||||||| Sbjct 158 TGATCGTCCTCGCCTTCGCTTACGCGATCTGCAAGTTCCTTCTTATGCTCATTCCTCCCA 217 Query 136 ATGTTCCTTCCATTGAC-TTAGACGCATCCGATG 168 ||||||||||||||||| || ||||||||||||| Sbjct 218 ATGTTCCTTCCATTGACGTT-GACGCATCCGATG 250 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 13421488983 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5