BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg923925 Length=409 Score E Sequences producing significant alignments: (Bits) Value AT5G06830.1 | Symbols: | unknown protein; CONTAINS InterPro DO... 143 1e-33 > AT5G06830.1 | Symbols: | unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF773 (InterPro:IPR008491); Has 365 Blast hits to 359 proteins in 109 species: Archae - 9; Bacteria - 13; Metazoa - 209; Fungi - 7; Plants - 47; Viruses - 0; Other Eukaryotes - 80 (source: NCBI BLink). | chr5:2116783-2119629 REVERSE LENGTH=1819 Length=1819 Score = 143 bits (77), Expect = 1e-33 Identities = 91/98 (93%), Gaps = 0/98 (0%) Strand=Plus/Plus Query 14 TCGAAGAATGGTTAGTGGATCGGAAGAGAATTTCGGCGGACTGGAGGAAGAGGGTGGCTG 73 ||| ||||||||| |||||||||||||||||| ||||||| |||||||||||||| |||| Sbjct 126 TCGGAGAATGGTTGGTGGATCGGAAGAGAATTCCGGCGGATTGGAGGAAGAGGGTTGCTG 185 Query 74 CGATCAGAGTCAAAATCTTAAAAGAGTTCTCTGCTTTG 111 ||||||||||||||||||||||||||||||| ||||| Sbjct 186 TGATCAGAGTCAAAATCTTAAAAGAGTTCTCTTCTTTG 223 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 19353083365 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5