BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg923942 Length=1214 Score E Sequences producing significant alignments: (Bits) Value AT1G30920.1 | Symbols: | F-box family protein | chr1:11004242-... 54.7 2e-06 > AT1G30920.1 | Symbols: | F-box family protein | chr1:11004242-11005444 REVERSE LENGTH=1203 Length=1203 Score = 54.7 bits (29), Expect = 2e-06 Identities = 29/29 (100%), Gaps = 0/29 (0%) Strand=Plus/Plus Query 651 GTTTGCTTTGATGTTAGGTCTGAGAATTT 679 ||||||||||||||||||||||||||||| Sbjct 706 GTTTGCTTTGATGTTAGGTCTGAGAATTT 734 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 59638247460 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5