BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg924010 Length=1048 Score E Sequences producing significant alignments: (Bits) Value AT4G08263.1 | Symbols: | FUNCTIONS IN: molecular_function unkn... 84.2 2e-15 > AT4G08263.1 | Symbols: | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; BEST Arabidopsis thaliana protein match is: DNA-binding storekeeper protein-related transcriptional regulator (TAIR:AT4G00610.1); Has 52 Blast hits to 52 proteins in 2 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 52; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr4:5211604-5212137 REVERSE LENGTH=330 Length=330 Score = 84.2 bits (45), Expect = 2e-15 Identities = 49/51 (96%), Gaps = 0/51 (0%) Strand=Plus/Plus Query 179 CGCATCTCTAGCGAAGAAGCCGTTGGAAGTCGTCGCATCGACTTCGAAGAA 229 ||||||||| ||||||||||||||||||||||||||||| ||||||||||| Sbjct 47 CGCATCTCTGGCGAAGAAGCCGTTGGAAGTCGTCGCATCAACTTCGAAGAA 97 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 51389532381 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5