BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg924085 Length=304 Score E Sequences producing significant alignments: (Bits) Value AT1G04430.1 | Symbols: | S-adenosyl-L-methionine-dependent met... 75.0 4e-13 > AT1G04430.1 | Symbols: | S-adenosyl-L-methionine-dependent methyltransferases superfamily protein | chr1:1198118-1201527 FORWARD LENGTH=2379 Length=2379 Score = 75.0 bits (40), Expect = 4e-13 Identities = 44/46 (96%), Gaps = 0/46 (0%) Strand=Plus/Plus Query 145 ATGTCATCAAAAGTCAAATCAAACACTGTGAGGAACATAATAGACA 190 |||||||| |||||||||||||||||||||||||||||||| |||| Sbjct 1632 ATGTCATCGAAAGTCAAATCAAACACTGTGAGGAACATAATGGACA 1677 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14074969720 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5