BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg924204 Length=593 Score E Sequences producing significant alignments: (Bits) Value AT1G47890.1 | Symbols: AtRLP7, RLP7 | receptor like protein 7 |... 78.7 6e-14 > AT1G47890.1 | Symbols: AtRLP7, RLP7 | receptor like protein 7 | chr1:17643976-17647035 FORWARD LENGTH=3060 Length=3060 Score = 78.7 bits (42), Expect = 6e-14 Identities = 52/57 (91%), Gaps = 0/57 (0%) Strand=Plus/Plus Query 149 AAATTCCAGTCGAGCTGCTTCAGCTAACTAAGTTGGTGTCTCTCGATCTTTCTTCTA 205 |||||||| || | || ||||||||||| |||||||||||||||||||||||||||| Sbjct 545 AAATTCCAATCAATCTTCTTCAGCTAACAAAGTTGGTGTCTCTCGATCTTTCTTCTA 601 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 28532995496 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5