BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg924354 Length=448 Score E Sequences producing significant alignments: (Bits) Value AT1G56520.2 | Symbols: | Disease resistance protein (TIR-NBS-L... 78.7 4e-14 > AT1G56520.2 | Symbols: | Disease resistance protein (TIR-NBS-LRR class) family | chr1:21174664-21178974 REVERSE LENGTH=3624 Length=3624 Score = 78.7 bits (42), Expect = 4e-14 Identities = 53/58 (91%), Gaps = 1/58 (2%) Strand=Plus/Plus Query 223 TCGACATTATTGAATGTGGTGTCCAGATCTTGATGGATGAAACAGATGGAAGTAACAA 280 ||| ||||||||||||||||||||||||||||||||| ||||| || ||||| ||||| Sbjct 2889 TCG-CATTATTGAATGTGGTGTCCAGATCTTGATGGACGAAACGGACGGAAGCAACAA 2945 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 21313525576 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5