BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg924422 Length=1471 Score E Sequences producing significant alignments: (Bits) Value AT3G26010.1 | Symbols: | Galactose oxidase/kelch repeat superf... 110 5e-23 > AT3G26010.1 | Symbols: | Galactose oxidase/kelch repeat superfamily protein | chr3:9511901-9513316 FORWARD LENGTH=1416 Length=1416 Score = 110 bits (59), Expect = 5e-23 Identities = 74/81 (91%), Gaps = 1/81 (1%) Strand=Plus/Plus Query 1273 TCCCACGGTGGATGGAATCGCTGCCTTGTCCTCCCCAAGTTGAGATGATGGATACAACTT 1332 |||||||||||||||||||| ||||||||||||||||||||||||||||| ||||| ||| Sbjct 1124 TCCCACGGTGGATGGAATCGGTGCCTTGTCCTCCCCAAGTTGAGATGATGAATACAGCTT 1183 Query 1333 CAGTACTCTCTTACATT-CTT 1352 | ||| |||||||| || ||| Sbjct 1184 CGGTAATCTCTTACGTTACTT 1204 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 72539787525 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5