BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg924851 Length=343 Score E Sequences producing significant alignments: (Bits) Value AT1G61688.1 | Symbols: | Defensin-like (DEFL) family protein |... 128 3e-29 > AT1G61688.1 | Symbols: | Defensin-like (DEFL) family protein | chr1:22780733-22781388 REVERSE LENGTH=413 Length=413 Score = 128 bits (69), Expect = 3e-29 Identities = 110/130 (85%), Gaps = 1/130 (1%) Strand=Plus/Plus Query 4 aaaaaatta-tatataaaaaatggttatcaccacaaaaaaTCTAATCACATTTGTTTTCG 62 ||||||| | ||||||||||||| || |||| |||||| |||||| ||||||||||| Sbjct 16 AAAAAATAAGAATATAAAAAATGGCTAACACCCCAAAAACCCTAATCGCATTTGTTTTCA 75 Query 63 GTGTCATTTTCATCATATCTTATGTTCATTGTCATACAACAACTGCTAGTGCTCCAGGCG 122 | || ||| ||||||||||||||||||||||||||||||||| ||| ||||| ||| || Sbjct 76 GCGTTATTGTCATCATATCTTATGTTCATTGTCATACAACAATTGCAAGTGCCCCAAGCA 135 Query 123 GGGGTGGACC 132 | |||| ||| Sbjct 136 GTGGTGAACC 145 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 16035411931 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5