BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg925001 Length=964 Score E Sequences producing significant alignments: (Bits) Value AT5G37240.1 | Symbols: | unknown protein; Has 0 Blast hits to ... 84.2 2e-15 > AT5G37240.1 | Symbols: | unknown protein; Has 0 Blast hits to 0 proteins in 0 species (source: NCBI BLink). | chr5:14737560-14739256 REVERSE LENGTH=477 Length=477 Score = 84.2 bits (45), Expect = 2e-15 Identities = 59/66 (89%), Gaps = 0/66 (0%) Strand=Plus/Plus Query 88 TAAGGAGAATGGATTCTTATGCTGCAGAGGCAAATCATTGGGGAGACGATTGGGTAGCCA 147 ||| |||||||||||||||| || |||| ||| ||| |||||||||||||||||||||| Sbjct 165 TAATGAGAATGGATTCTTATACTATAGAGACAACTCACTGGGGAGACGATTGGGTAGCCA 224 Query 148 AGAGAA 153 |||||| Sbjct 225 AGAGAA 230 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 47169864033 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5