BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg925245 Length=826 Score E Sequences producing significant alignments: (Bits) Value AT3G18340.1 | Symbols: | F-box and associated interaction doma... 65.8 6e-10 AT2G07120.1 | Symbols: | F-box associated ubiquitination effec... 65.8 6e-10 > AT3G18340.1 | Symbols: | F-box and associated interaction domains-containing protein | chr3:6294018-6295134 FORWARD LENGTH=1086 Length=1086 Score = 65.8 bits (35), Expect = 6e-10 Identities = 42/45 (93%), Gaps = 1/45 (2%) Strand=Plus/Plus Query 289 AATAATGTGTCCTTGAATGGAAATTTGTATTGGCCAGCTTACAAT 333 ||| ||||||||||||||||||||||||||||| | ||||||||| Sbjct 557 AAT-ATGTGTCCTTGAATGGAAATTTGTATTGGACTGCTTACAAT 600 > AT2G07120.1 | Symbols: | F-box associated ubiquitination effector family protein | chr2:2953605-2954722 REVERSE LENGTH=1062 Length=1062 Score = 65.8 bits (35), Expect = 6e-10 Identities = 42/45 (93%), Gaps = 1/45 (2%) Strand=Plus/Plus Query 289 AATAATGTGTCCTTGAATGGAAATTTGTATTGGCCAGCTTACAAT 333 ||| ||||||||||||||||||||||||||||| | ||||||||| Sbjct 533 AAT-ATGTGTCCTTGAATGGAAATTTGTATTGGACTGCTTACAAT 576 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 40237551747 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5