BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg925524 Length=269 Score E Sequences producing significant alignments: (Bits) Value AT3G20020.1 | Symbols: ATPRMT6, PRMT6 | protein arginine methyl... 150 5e-36 > AT3G20020.1 | Symbols: ATPRMT6, PRMT6 | protein arginine methyltransferase 6 | chr3:6983705-6988099 REVERSE LENGTH=1812 Length=1812 Score = 150 bits (81), Expect = 5e-36 Identities = 105/117 (90%), Gaps = 0/117 (0%) Strand=Plus/Plus Query 46 GAGCTTGAACTAAAATACAAGAAAGTCCCCGGTCTCAGCTCTTTTGGCAGAGCCAAGGGG 105 ||||||||| | || ||||| ||| |||| ||||||||||||||||| |||||||| | Sbjct 206 GAGCTTGAATTGGAAGACAAGCAAGGCCCCAGTCTCAGCTCTTTTGGCCGAGCCAAGAAG 265 Query 106 CGCAGTCACGCCGGAGCTCATGACCCTAGAGGCGGTCTCGCCAATGTGCTTAGGGTT 162 ||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| Sbjct 266 CGCAGTCACGCCGGAGCTCGTGACCCTCGAGGCGGTCTCGCCAATGTGCTTAGGGTT 322 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 12315598505 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5