BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg925838 Length=1409 Score E Sequences producing significant alignments: (Bits) Value AT3G09140.1 | Symbols: | Protein of unknown function (DUF674) ... 73.1 7e-12 > AT3G09140.1 | Symbols: | Protein of unknown function (DUF674) | chr3:2800853-2802795 REVERSE LENGTH=1856 Length=1856 Score = 73.1 bits (39), Expect = 7e-12 Identities = 79/98 (81%), Gaps = 4/98 (4%) Strand=Plus/Plus Query 27 AAAGATAAGTCTGAAAATTCT-AGTTGATAAAGAGAAAAACAAGATTGTTTTGG-TGGAA 84 |||| ||||| ||| | |||| | | ||| || ||| |||||| |||| |||| | ||| Sbjct 46 AAAGCTAAGTGTGAGACTTCTCA-TAGATGAACTGAAGAACAAGGTTGTCTTGGCT-GAA 103 Query 85 GCACGTAAAGATTTTGTTGATGTTCTCTTTAGTTTTCT 122 | |||| ||||||||||||||||||||||||||||| Sbjct 104 TCTGGTAAGGATTTTGTTGATGTTCTCTTTAGTTTTCT 141 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 69427353735 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5