BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg926663 Length=206 Score E Sequences producing significant alignments: (Bits) Value AT4G11830.2 | Symbols: PLDGAMMA2 | phospholipase D gamma 2 | ch... 93.5 7e-19 > AT4G11830.2 | Symbols: PLDGAMMA2 | phospholipase D gamma 2 | chr4:7115794-7121245 REVERSE LENGTH=3858 Length=3858 Score = 93.5 bits (50), Expect = 7e-19 Identities = 52/53 (98%), Gaps = 0/53 (0%) Strand=Plus/Plus Query 29 TGAAGAAATCTCAATCCAAGCACAGTCTTCACTCATCTTCCTTCTCTTCGGCC 81 ||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 216 TGAAGAAATCTCAATCCAAGCACAGTCTTCACTCATCTTCCTTCTCTTCCGCC 268 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 9205147233 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5