BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg926782 Length=240 Score E Sequences producing significant alignments: (Bits) Value AT4G06477.1 | Symbols: | transposable element gene | chr4:3060... 117 5e-26 > AT4G06477.1 | Symbols: | transposable element gene | chr4:3060975-3065294 REVERSE LENGTH=4320 Length=4320 Score = 117 bits (63), Expect = 5e-26 Identities = 65/66 (98%), Gaps = 0/66 (0%) Strand=Plus/Minus Query 172 GGATGCGATCATACTAGCACTAATGCACCGGATCCCATCAGAACTCCGCAGTTAAGCGTG 231 |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4149 GGATGCGATCATACCAGCACTAATGCACCGGATCCCATCAGAACTCCGCAGTTAAGCGTG 4090 Query 232 CTTGGG 237 |||||| Sbjct 4089 CTTGGG 4084 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 10857833784 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5