BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg928020 Length=1202 Score E Sequences producing significant alignments: (Bits) Value AT4G29970.1 | Symbols: | F-box and associated interaction doma... 63.9 3e-09 > AT4G29970.1 | Symbols: | F-box and associated interaction domains-containing protein | chr4:14662765-14663917 REVERSE LENGTH=852 Length=852 Score = 63.9 bits (34), Expect = 3e-09 Identities = 83/105 (79%), Gaps = 9/105 (9%) Strand=Plus/Plus Query 828 GTGAACTACAATGGAAAGATAGCTTTAACGAGACAGTACTCTAAATTA-GGTCCACTTTA 886 |||||||||||||||||||||||||||||||| |||||| | | ||| ||||| | Sbjct 550 GTGAACTACAATGGAAAGATAGCTTTAACGAGT---TACTCTTG-TAACGGTACACTTGA 605 Query 887 CCTGTGGATTCTGGA--A-GATGCCCGCAAACAAGAATGGT-CAA 927 | ||||| || || | | ||||| | ||||||||||||| ||| Sbjct 606 CTTGTGGGTTATGAAGGATGATGCTAGTAAACAAGAATGGTTCAA 650 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 59035840920 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5