BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg928139 Length=274 Score E Sequences producing significant alignments: (Bits) Value AT3G05450.1 | Symbols: | CONTAINS InterPro DOMAIN/s: Cystatin-... 147 7e-35 > AT3G05450.1 | Symbols: | CONTAINS InterPro DOMAIN/s: Cystatin-related, plant (InterPro:IPR006525); BEST Arabidopsis thaliana protein match is: Cystatin/monellin superfamily protein (TAIR:AT3G05685.1); Has 2098 Blast hits to 1525 proteins in 202 species: Archae - 2; Bacteria - 561; Metazoa - 485; Fungi - 302; Plants - 191; Viruses - 20; Other Eukaryotes - 537 (source: NCBI BLink). | chr3:1573909-1576418 REVERSE LENGTH=1323 Length=1323 Score = 147 bits (79), Expect = 7e-35 Identities = 100/110 (91%), Gaps = 2/110 (2%) Strand=Plus/Plus Query 117 CATTTGCTGCAAGAGAGTTTGAGTT-TCCAGATGCACCTTTAGTGGAGTATCAAGCTAAG 175 |||||||||||||||||| ||| || |||||||||||||| || |||||||||||||||| Sbjct 491 CATTTGCTGCAAGAGAGTCTGA-TTCTCCAGATGCACCTTCAGAGGAGTATCAAGCTAAG 549 Query 176 GCCGCATGGTCTGTAACCAACAAGACTTATCCCATGTTTTGTAGACCAAG 225 ||||||||||||| | || | |||||||||||||| |||||||||||||| Sbjct 550 GCCGCATGGTCTGCAGCCGAGAAGACTTATCCCATCTTTTGTAGACCAAG 599 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 12566937250 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5