BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg928331 Length=311 Score E Sequences producing significant alignments: (Bits) Value AT4G14805.1 | Symbols: | Bifunctional inhibitor/lipid-transfer... 182 2e-45 > AT4G14805.1 | Symbols: | Bifunctional inhibitor/lipid-transfer protein/seed storage 2S albumin superfamily protein | chr4:8502374-8503199 REVERSE LENGTH=660 Length=660 Score = 182 bits (98), Expect = 2e-45 Identities = 113/120 (94%), Gaps = 2/120 (2%) Strand=Plus/Plus Query 172 caccaccaccaccaccaGTTCCACAATACATCTCAAGCGACTCTC-CAAAGATCAGAAAC 230 |||||||||||| |||||||| ||||||| ||||||||||||||| | |||||||||||| Sbjct 542 CACCACCACCACTACCAGTTCTACAATACTTCTCAAGCGACTCTCTC-AAGATCAGAAAC 600 Query 231 TTCTGGTTTCCATTGACTATCATCATGACTTTTGCCACTTCTATTCTCACTCGTATCTGA 290 ||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||| Sbjct 601 TTCTGGTTTCCATCGACTATCATCATGACTTTTGCCACTTCTATTCTCGCTCGTATCTGA 660 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 14426843963 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5