BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg928904 Length=385 Score E Sequences producing significant alignments: (Bits) Value AT3G11880.1 | Symbols: | Protein of unknown function DUF2359, ... 178 4e-44 > AT3G11880.1 | Symbols: | Protein of unknown function DUF2359, transmembrane | chr3:3751660-3754060 FORWARD LENGTH=1707 Length=1707 Score = 178 bits (96), Expect = 4e-44 Identities = 118/129 (91%), Gaps = 0/129 (0%) Strand=Plus/Plus Query 240 GAAGCTGACAAGTCCTGCAAAGTGATCTTGGGTAGACTCTTCCGTGAAAGTGGCTGCGTC 299 |||||||||||||||||||||||||| | ||||||| |||||| ||||| || |||| || Sbjct 1244 GAAGCTGACAAGTCCTGCAAAGTGATGTCGGGTAGATTCTTCCCTGAAAATGCCTGCCTC 1303 Query 300 AAAGGTACAGCCATTATTACTGCTGTGGTTCTAGCTGCTGCAGTTATACTATCTTCCAAC 359 |||||||||||||||||||||||||||||||||||||||| || | ||||| |||||||| Sbjct 1304 AAAGGTACAGCCATTATTACTGCTGTGGTTCTAGCTGCTGTAGCTGTACTAGCTTCCAAC 1363 Query 360 CTGTAGGCT 368 ||||||||| Sbjct 1364 CTGTAGGCT 1372 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 18146657389 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5