BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg929216 Length=236 Score E Sequences producing significant alignments: (Bits) Value AT3G25400.1 | Symbols: | CONTAINS InterPro DOMAIN/s: NTP Pyrop... 156 1e-37 > AT3G25400.1 | Symbols: | CONTAINS InterPro DOMAIN/s: NTP Pyrophosphohydrolase MazG-related, RS21-C6 (InterPro:IPR011394), EAR (InterPro:IPR009039), NTP pyrophosphohydrolase MazG, putative catalytic core (InterPro:IPR004518); Has 1123 Blast hits to 1121 proteins in 452 species: Archae - 22; Bacteria - 753; Metazoa - 81; Fungi - 3; Plants - 83; Viruses - 0; Other Eukaryotes - 181 (source: NCBI BLink). | chr3:9213156-9214281 FORWARD LENGTH=643 Length=643 Score = 156 bits (84), Expect = 1e-37 Identities = 92/96 (96%), Gaps = 0/96 (0%) Strand=Plus/Plus Query 141 GGTGGGTGAAGTGGGAGAGCTATCAGAGATATTCCAATGGAAAGGAGAAGTGGCAAGAGG 200 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct 215 GGTGGGTGAAGTGGGAGAGCTATCAGAGATATTCCAATGGAAAGGAGAAGTAGCAAGAGG 274 Query 201 ATGTCCAGATTGGTAAGAAGAAGAGAAATTGCATCT 236 ||||||||||||| |||||||||||||| | ||||| Sbjct 275 ATGTCCAGATTGGAAAGAAGAAGAGAAAGTCCATCT 310 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 10656762788 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5