BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg929217 Length=271 Score E Sequences producing significant alignments: (Bits) Value AT3G25980.1 | Symbols: MAD2 | DNA-binding HORMA family protein ... 130 7e-30 > AT3G25980.1 | Symbols: MAD2 | DNA-binding HORMA family protein | chr3:9503056-9504670 FORWARD LENGTH=1074 Length=1074 Score = 130 bits (70), Expect = 7e-30 Identities = 74/76 (97%), Gaps = 0/76 (0%) Strand=Plus/Plus Query 21 ATGGCGTCCAAAATAGTGGCTGCTAAAGATATCATCACTTTACACGGATCTGCTGCCATC 80 ||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| Sbjct 177 ATGGCGTCCAAAACAGCGGCTGCTAAAGATATCATCACTTTACACGGATCTGCTGCCATC 236 Query 81 GTCAGCGAATTCTTCT 96 |||||||||||||||| Sbjct 237 GTCAGCGAATTCTTCT 252 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 12416134003 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5