BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg929589 Length=346 Score E Sequences producing significant alignments: (Bits) Value AT3G17360.1 | Symbols: POK1 | phragmoplast orienting kinesin 1 ... 108 4e-23 > AT3G17360.1 | Symbols: POK1 | phragmoplast orienting kinesin 1 | chr3:5936108-5946466 FORWARD LENGTH=6462 Length=6462 Score = 108 bits (58), Expect = 4e-23 Identities = 73/79 (92%), Gaps = 6/79 (8%) Strand=Plus/Minus Query 274 CCAATTGCAGCAACATGTTATATGCATTCTTATACACAACAATTCCAATTTAA--CAC-- 329 ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct 6462 CCAATTGCAGCAACATGTTATATGCATTCTTATACACAACAATTCCAATTTAAGACACTC 6403 Query 330 ACACA-AAAA-GTTAACCA 346 ||||| |||| |||||||| Sbjct 6402 ACACACAAAAAGTTAACCA 6384 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 16186215178 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5