BLASTN 2.2.26+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: TAIR10_cdna_20110103_representative_gene_model_updated 33,602 sequences; 51,074,197 total letters Query= Ahg929866 Length=541 Score E Sequences producing significant alignments: (Bits) Value AT3G19663.1 | Symbols: | unknown protein; Has 30201 Blast hits... 130 1e-29 > AT3G19663.1 | Symbols: | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr3:6826768-6826911 FORWARD LENGTH=144 Length=144 Score = 130 bits (70), Expect = 1e-29 Identities = 129/155 (83%), Gaps = 14/155 (9%) Strand=Plus/Minus Query 176 TTATGTACCAAATGTTGAAGCAAGGAGAGTAGATCCAAGTGTCGTAAGCGATG-AAACAT 234 ||||||| |||| | ||||||||||||||| ||||||||| ||||| |||| ||| || Sbjct 144 TTATGTA-CAAA--ATAAAGCAAGGAGAGTAGGTCCAAGTGTTGTAAGTGATGCAAA-AT 89 Query 235 CTCTA-CCTTCTCCATCGTTTTTC-AGAGCAAATATTGGAACGAAAAGATTGGTACCAAG 292 ||| | || ||| |||| ||||| |||||| |||| ||||||||||||||||||||||| Sbjct 88 CTCCATCC-TCTTCATC-ATTTTCAAGAGCAGATATCGGAACGAAAAGATTGGTACCAAG 31 Query 293 CGGTCCGAACAATGCAACATCTCCACCTTCTCCAT 327 ||||||| |||||||||||| ||||||||| Sbjct 30 CGGTCCG-----TGCAACATCTCCGGCTTCTCCAT 1 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 25920819852 Database: TAIR10_cdna_20110103_representative_gene_model_updated Posted date: Sep 25, 2014 6:13 PM Number of letters in database: 51,074,197 Number of sequences in database: 33,602 Matrix: blastn matrix 1 -2 Gap Penalties: Existence: 0, Extension: 2.5